2018 Sci Rep
PMID: 27752108
DOI: 10.1038/srep35576
Detail
General Information
CircRNA | hsa_circ_0067934 | Species | Homo sapiens |
Location | chr3:170013698-170015181 | OMIM ID | 600539 |
Method | Microarray/qRT-PCR | Detection Tool | - |
Gene Symbol | PRKCI | Gene Description | protein kinase C iota |
Function | Proliferation and migration of esophageal squamous cell carcinoma cells; hsa_circ_0067934 represents a novel potential biomarker and therapeutic target of esophageal squamous cell carcinoma. hsa_circ_0067934 functions as a sponge for both miR-545 and miR-589 and abrogates their suppression of the pro-tumorigenic transcription factor E2F7. hsa_circ_0067934 promotes tumor growth in lung adenocarcinoma; down-regulation of hsa_circ_0067934 inhibits cell migration and proliferation in Hirschsprung disease by suppressing the expression of miR-1324 target PLCB1. |
Expression profiles of hsa_circ_0067934
Tissue | Hirschsprung disease aganglionic tissues | Esophageal squamous cell carcinoma | Lung adenocarcinoma |
Expression | Down | Up | Up |
GO:0006468 | protein phosphorylation | biological process |
GO:0006612 | protein targeting to membrane | biological process |
GO:0007010 | cytoskeleton organization | biological process |
GO:0007015 | actin filament organization | biological process |
GO:0010976 | positive regulation of neuron projection development | biological process |
GO:0016192 | vesicle-mediated transport | biological process |
GO:0016477 | cell migration | biological process |
GO:0018105 | peptidyl-serine phosphorylation | biological process |
GO:0032869 | cellular response to insulin stimulus | biological process |
GO:0034351 | negative regulation of glial cell apoptotic process | biological process |
GO:0035089 | establishment of apical/basal cell polarity | biological process |
GO:0035556 | intracellular signal transduction | biological process |
GO:0042462 | eye photoreceptor cell development | biological process |
GO:0043066 | negative regulation of apoptotic process | biological process |
GO:0043524 | negative regulation of neuron apoptotic process | biological process |
GO:0045197 | establishment or maintenance of epithelial cell apical/basal polarity | biological process |
GO:0045216 | cell-cell junction organization | biological process |
GO:0046326 | positive regulation of glucose import | biological process |
GO:0046903 | secretion | biological process |
GO:0048194 | Golgi vesicle budding | biological process |
GO:0051092 | positive regulation of NF-kappaB transcription factor activity | biological process |
GO:0060252 | positive regulation of glial cell proliferation | biological process |
GO:0061024 | membrane organization | biological process |
GO:0070555 | response to interleukin-1 | biological process |
GO:0070830 | bicellular tight junction assembly | biological process |
GO:1903078 | positive regulation of protein localization to plasma membrane | biological process |
GO:2000353 | positive regulation of endothelial cell apoptotic process | biological process |
GO:0000139 | Golgi membrane | cellular component |
GO:0005634 | nucleus | cellular component |
GO:0005768 | endosome | cellular component |
GO:0005829 | cytosol | cellular component |
GO:0005886 | plasma membrane | cellular component |
GO:0005923 | bicellular tight junction | cellular component |
GO:0015630 | microtubule cytoskeleton | cellular component |
GO:0016324 | apical plasma membrane | cellular component |
GO:0031252 | cell leading edge | cellular component |
GO:0043220 | Schmidt-Lanterman incisure | cellular component |
GO:0043234 | protein complex | cellular component |
GO:0045171 | intercellular bridge | cellular component |
GO:0070062 | extracellular exosome | cellular component |
GO:0004672 | protein kinase activity | molecular function |
GO:0004674 | protein serine/threonine kinase activity | molecular function |
GO:0004697 | protein kinase C activity | molecular function |
GO:0005515 | protein binding | molecular function |
GO:0005524 | ATP binding | molecular function |
GO:0005543 | phospholipid binding | molecular function |
GO:0019904 | protein domain specific binding | molecular function |
GO:0046872 | metal ion binding | molecular function |
If your download hasn't started, click here
>hsa_circ_0067934|ENST00000295797 GTTATTTTGGAAAAACAAATTCGCATACCACGTTCTCTGTCTGTAAAAGCTGCAAGTGTTCTGAAGAGTTTTCTTAATAAGGACCCTAAGGAACGATTGGGTTGTCATCCTCAAACAGGATTTGCTGATATTCAGGGACACCCGTTCTTCCGAAATGTTGATTGGGATATG