CH-seq protocol

Combinatorial hybridization sequencing (CH-seq) is a flexible pool-split based high-throughput (10,000-4 million cells/nuclei per experiment) single cell/nucleus library preparation method. This strategy could apply to single cell/nucleus RNA sequencing, single nucleus DNA sequencing (chromatin accessibility) as well as other omics.

Work flow

1.Single cells/nuclei preparation.
2.Cells/nuclei fixation by paraformaldehyde/formaldehyde
3.Membrane permeabilization, filtering and counting.
4.Reverse transcription with 1st barcoded polyT oligos (CH-RNA-seq) or tagmentation with 1st barcoded transposase (CH-ATAC-seq) into one or more 96-well plates. Pool and randomly redistribute cells/nuclei into one or more 96-well plates.
5.1st polyT barcode oligos (CH-RNA-seq) or transposase adaptor oligos (CH-ATAC-seq) hybridized with 2nd barcoded annealing oligos without ligase in hybridization buffer.
6.Block extra free annealing hybridization oligos. Pool and randomly redistribute cells/nuclei into one or more 96-well plates.
7.In-cells/nuclei second strand synthesis (CH-RNA-seq) or gap filling (CH-ATAC-seq). Lysis, purification, tagmentation and indexed PCR (CH-RNA-seq) or directly indexed PCR (CH-ATAC-seq).
8.Library purification and sequencing.

Materials and equipment

Oligos and Reagents

1. 384 barcoded oligodT primers, 384 barcoded transposase adaptor primers, 768 barcoded hybridization annealing primers, block oligo, 96 index PCR primers (see below Table S1).
2. DNase/RNase free water.
3. DEPC Treated Water.
4. DNase/RNase free pipet tips.
5. Cell strainers (20um, 40um).
6. Paraformaldehyde/formaldehyde aqueous solutions.
7. 1X phosphate buffered saline (PBS), 1X dulbecco's modified eagle medium (DMEM)
8. 1M Tris-HCL (pH 7.5)
9. 3M NaCl
10. 1M MgCl2
11. IGPAL-CA 630
12. Tween-20
13. Glycerol.
14. Mg (OAc)2
15. Polyethylene glycol (PEG 8000).
16. 0.5M Ethylene Diamine Tetraacetic Acid (EDTA).
17. HCl solution.
18. Dithiothreitol (DTT).
19. Bovine Serum Albumin (BSA, 20mg/ml).
20. Murine RNase inhibitor (Vazyme biotech).
21. Triton X-100 (molecular biology grade).
22. 10mM dNTPs.
23. 10mM ATPs.
24. Sodium dodecyl sulfate (SDS).
25. Proteinase K.
26. Phenylmethyl sulfonyl fluoride (PMSF).
27. N'N-Dimethylformamide (DMF).
28. Digitonin.
29. Spermidine.
30. T4 Polynucleotide Kinase (NEB).
31. Reverse transcriptase (Thermo recommended).
32. TruePrep DNA Library Prep Kit V2 (Vazyme biotech, cat#TD511, for CH-RNA-seq tagmentation).
33. Transposase Tn5 without adaptor embedding (Vazyme biotech, cat#S111, for CH-ATAC-seq).
34. RNA second strand synthesis module (NEB, cat#E6111L, for CH-RNA-seq).
35. VAHTS DNA Clean Beads (Vazyme Biotech).
36. Ampligase DNA ligase (Lucigen, for CH-ATAC-seq).
37. T4 DNA polymerse (NEB, for CH-ATAC-seq).
38. KAPA HiFi HotStart ReadyMix (Kapa Biosystems).
39. VAHTS® Circularization Kit for MGI (Vazyme).
40. Qubit dsDNA kit (Invitrogen).
41. Qubit ssDNA kit (Invitrogen).
42. Qubit tubes (Invitrogen).
43. DNBSEQ-T7RS high-throughput sequencing kit (MGI, cat#1000016105).

Equipment

1. Centrifuge.
2. Ice markers.
3. DNase/RNase free Lo-bind 96-well plates.
4. DNase/RNase free Lo-bind centrifuge tubes (1.5ml, 15ml, 50ml).
5. 96-well PCR machine.
6. Incubator.
7. Rotator.
8. Microscope.
9. Multi-channel pipets (10ul, 50ul).
10. Hemocytometer.
11. Self-adhesive Sealing Film for Microplate.
12. Refrigerator (4°C) and freezer (-20°C and -80°C).
13. Qubit 3.0.
14. DNBSEQ-T7 platform (MGI).

Protocols

Download CH-Protocols

Table 1 oligonucleotide sequences used in CH-seq

Oligonucleotie name	Sequence
HY_head_oligo	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Block_tail_primer_oligo	AAGCAGTGGTATCAACGCAGAGT
Tn5 primer A oligo	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Tn5 ME oligo	CTGTCTCTTATACACATCT
PCR P5 primer	GAACGACATGGCTACGATCCGACTTTCGTCGGCAGCGTC