Microwell-seq protocol

Materials

We taught a local company (G-Bio Biotechnology Co. Ltd) to provide Microwell-seq Kit/Service http://www.igeneseq.com/research_detail/dxbcp/microwell.html

Preparation of beads

Beads were washed twice with 1 ml of 100% EtOH and twice with 1 ml of TE/TW (10 mM Tris pH 8.0, 1 mM EDTA, 0.01% Tween). The bead pellet was resuspended in 1ml TE/TW for long-term storage at 4 ºC. For Microwell- Seq, 50 µl beads suspension was removed from the stock tube, washed twice with 500 µl of DPBS/EDTA (20 mM EDTA), then resuspended in 500 µl of DPBS/EDTA for a bead concentration (1:10, stock bead: bead for use). 500 µl diluted bead suspension was used for one experiment.

Fabrication of microwell array

PDMS washed once by 100% EtOH, twice by H2O and air drying. Agarose (5%) microwell arrays were cast from the PDMS before each experiment. Agarose microwell arrays could with DPBS/EDTA for short-term storage at 4ºC (in 10 days).

Protocol

Cell collection and lysis

Cell concentration should be carefully controlled in Microwell-seq. Both cell and bead concentrations were estimated by hemocytometer. The proper cell concentration is ~ 170,000 cells/ml (10% wells will be occupied by single cells). Evenly distributed cell suspension were pipetted onto microwell array (5 min~10 min) and extra cells were washed away. To eliminate cell doublets, the microwell plate was inspected under a microscope and microwell with overfull cell doublets can be discarded. Bead suspension(500 µl) was then loaded on the microwell plate which was placed on a magnet. Excess beads were washed away slowly. Cold lysis buffer (0.1 M Tris-HCL pH 7.5, 0.5 M LiCl, 1% LiSDS, 10 mM EDTA, and 5 mM dithiothreitol) was pipetted over the surface of the plate, and removed away after 10 min incubation. Then beads were collected and transferred to an RNase-free tube, washed twice with 200 µl 6X SSC, and once with 200 µl of 5x RT buffer (or 50 mM Tris buffer).

Reverse transcription

Then 20 µl RT mix was added. The RT mix contained dNTP mix (1mM), 100U SuperScript II reverse transcriptase, 1x Superscript II first-strand buffer (Takara, cat #2690A), 10 U Rnase Inhibitor (Lucigen, cat #30281-2 or other brands), 1M Betaine (Sigma, cat #B0300-1VL) and 6 mM MgCl2 (Ambion, cat #AM9539G), 1 µM TSO_RT_primer (see table 1). The beads were incubated at 42ºC for 90 minutes (gently shake beads every 6 min). The beads were then washed once with 200 µl TE-SDS, once with 200 µl TE-TW, and once with 1X exonuclease I buffer (or 10 mM Tris pH 7.5).

Exonuclease I treatment

After washing by 1X exonuclease I buffer, beads were suspended in 200 µl exonuclease I mix (containing 1x exonuclease I buffer and 1 U/µl exonuclease I (NEB, cat #B0293S)), and incubated at 37ºC for 45minutes to remove oligonucleotides which did not capture mRNA. Beads were pooled and washed once with 200 µl TE-SDS, once with 200 µl TE-TW and once with 200 µl 10 mM Tris pH 7.5 (or ultrapure distilled water).

cDNA amplification

Beads were then distributed to 5 tubes. Every tube was added with 20 µl PCR mix, which includes 1x HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.4 µM TSO_PCR primer (see Table 1). The PCR program was as follows: 98ºC for 3 min, 14 cycles of (98ºC 20sec, 67ºC 15sec, 72ºC 6 min), 72ºC 5 min and 4ºC hold. Shake the PCR tube to mix the beads (first cDNA template) at the end of 98ºC in the first four cycles (important!). After pooling all PCR products, AMPure XP beads (Beckman Coulter, cat #A63881) were used to purify the cDNA library.

Transposase fragmentation and selective PCR

Prepare 3'-end cDNA fragments for sequencing by Nextera XT tagmentation reactions (Illumina, cat#FC-131-1096). Fragmentation reaction was done following the instructions of manufacturer. We replace the index 2 primers (N5xx) in the kit with our P5 primer (see Table 1) to specially amplify fragments which contain the 3' end of transcript. Other fragments will form self-loops, which impede their binding to PCR primers. PCR program is as follows: 72ºC 3 min, 98ºC 30 sec, 13-15 cycles of (98ºC 15 sec, 60ºC 30 sec, 72ºC 3 min), 72ºC 5 min and 4ºC hold. To eliminate primer dimer and large size fragments, 0.6 x AMPure XP beads were then used to purify cDNA library. Then size distribution was analyzed on an Agilent 2100 bioanalyzer, a peak at around 400~700bp range should be observed. Finally, the libraries were sequenced on the Illumina NextSeq 500 using 3 µl of 100 µM Read1CustSeq (see Table 1) for priming of read 1.

Table 1 Primer used in Microwell-seq

Primer	Sequence
TSO_RT primer	AAGCAGTGGTATCAACGCAGAGTGAAT/rG/rG/iXNA_G
TSO_PCR primer	AAGCAGTGGTATCAACGCAGAGT
P5 primer	AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C
Read1CustSeq	GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTACGT

Lineage composition